새우를  TE buffer(10 mM Tris HCl, 1 mM EDTA, pH 7.6)로 세척하고 두흉부를  extraction buffer( 10mM HEPES, 0.4 N NaCl, 1 mM EDTA, 1 mM EGTA, 1mM DTT, 2.5 mM phenylmethylsulfonylfluoride, 1/ml leupeptin, 1.6/ml pepstatin)에 담그고 bead beater를 이용하여 마쇄한다 (20 times of 20 s pulse and 20 s rest). Homogenate 5000 × g10분간 원심을 돌리고 상층액을 채취하여 0.45 membrane(cellulose acetate, Gelman Sciences)으로 filtering한였다. Filterate 4℃에서 100,000 × g1시간 원심을 돌리고 Pellet을 소량의 TE buffer(pH 8.0)에서 하룻밤 보관한다. Pellet을 부드럽게 재부유시킨 후 10% 50% discontinuous sucrose gradient에 에서 100,000 × g1시간 원심을 돌리고 Viral band를 피펫으로 채취하여 TE buffer에 넣고 4℃에서 100,000 × g로 원심을 한다. 원심 후 10%50% sucrose gradient 사이에 band가 형성되어 이를 채취한다. 이로부터 Genomic DNA를 추출한다. , 바이러스를 0.5% (W/V) SDS, 1mM EDTA, 1mg/ml proteinase K가 들어있는 TE buffer에 넣고 5℃에서 30분간 반응을 시킨후 Phenol-chloroform으로 추출하고 ethanol precipitation을 한다.  일본에서 확인한 RV-PJ643 bp를 증폭시키기 위하여 sense orientationprimer(5' GACAGAGATATGCACGCCAA3')antisense orientationprimer(5' ACCAGTGTTTCGTCATGGAG 3')를 이용한다. Reaction tube2㎍의 viral genomic DNA, 각각의 primer 100 pM, 각각의 dNTP 200μM, 10mM Tris-Cl(pH 8.8), 10mM (NH4)2SO4, 2mM MgSO4, 0.1% Triton X-100, Vent DNA polymerase (New England Biolabs, Inc. U.S.A.) 1U로 구성한다. Reaction tube1분간 95℃로 가열하여 DNAdenature 시키고 다시 55(annealing temperature for the remaining 30 cycles)로 식혀(annealing temperature for the first two cycles) 2분간  식힌 후, reaction tube72℃로 가열하여 2분간 incubaton시키고 마지막 cycle 후에 72℃에서 2분간  extension시킨다. 32 cycle의 증폭을 실시한다.

  WSBV1447 bp를 증폭시키기 위하여 대만에서 보고가 된 oligonucleotide primer를 사용한다. Reaction bufferRV-PJ에 사용하였던 것과 동일하게 한다. 증폭은 94 4, 50 1, 72 31 cycle94 4, 50 1, 72 332 cycles 그리고 마지막으로 40 cycle 후에 72℃에서 5분간의 extension으로 구성한다. PCR 산물을 0.8% agarose gel에 전기영동을 실시하여 분석한다.